circad | circRNAs associated with diseases

hsa_circRNA_100918
Gene	n/a	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	T2DM with depression	ICD-10	Type 2 diabetes mellitus (E11)
DBLink	Link to database	PMID	28779132
Experimental Method
Sample Type	Blood samples	Comparison	Seven patients with Type 2 Diabetics Mellitus T2DM (four women and three men, age range: 48-65 years, average age: 58.14 years) with current major depressive episodes (the DM1 group) and seven patients with T2DM (four women and three men, age range: 41-69 years, average age: 58.28 years) without major depressive episodes
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GGACACCTACTCATGAAATGTTTG Reverse TCAAATAAACTGTCTGCCAACTG	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Jiang, G, Ma, Y, An, T, Pan, Y, Mo, F, Zhao, D, Liu, Y, Miao, JN, Gu, YJ, Wang, Y, Gao, SH (2017). Relationships of circular RNA with diabetes and depression. Sci Rep, 7, 1:7285.